Browse articles
RESEARCH
J Carcinog2007,  6:13

The role of GSTM1 gene polymorphisms in lung cancer development in Turkish population


1 Yedikule Teaching Hospital for Chest Diseases and Thoracic Surgery, Depertmant of Thoracic Surgery, Istanbul, Turkey
2 Istanbul University, Istanbul Medical Faculty, Department of Medical Genetics, Istanbul, Turkey
3 Istanbul University, Istanbul Medical Faculty, Department of Chest Diseases, Istanbul, Turkey

Date of Submission27-Jun-2007
Date of Acceptance26-Sep-2007
Date of Web Publication26-Sep-2007

Correspondence Address:
Adalet Demir
Yedikule Teaching Hospital for Chest Diseases and Thoracic Surgery, Depertmant of Thoracic Surgery, Istanbul
Turkey
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.1186/1477-3163-6-13

  Abstract 

Background
Glutathione S-transferase (GSTs) plays an important role in the detoxification of many xenobiotics involved in the etiology of cancer. In different ethnic groups, variations in null allele frequency have been observed. We have investigated GSTM1 gene polymorphisms in healthy subjects and lung cancer patients in the Turkish population and reviewed the control subjects of the studies performed in the Turkish population.
Methods
Following blood sampling from patients and controls, DNA samples were extracted from the whole blood and were amplified by using polymerase chain reaction (PCR) method in all of the 256 cases, consisting of 102 previously diagnosed with lung cancer and 154 healthy controls.
Results
The prevalence of GSTM1-null genotype in the lung cancer patients was 49%, compared to 52.6% in the control group (OR = 1.39, 95% CI = 0.70-1.90, p = 0.57). There were also no significant relationships in GSTM1 genotypes among histopathologic types of lung cancers (p > 0.05). The frequency of GSTM1 was found to be 41.2% (n = 1809) when the control subjects of the studies performed in Turkish population were reviewed.
Conclusion
We have observed that GSTM1 genotype is not an independent risk factor for lung cancer.


How to cite this article:
Demir A, Altin S, Pehlivan D, Demir M, Yakar F, Seyhan EC, Dincer SI. The role of GSTM1 gene polymorphisms in lung cancer development in Turkish population. J Carcinog 2007;6:13

How to cite this URL:
Demir A, Altin S, Pehlivan D, Demir M, Yakar F, Seyhan EC, Dincer SI. The role of GSTM1 gene polymorphisms in lung cancer development in Turkish population. J Carcinog [serial online] 2007 [cited 2021 Oct 23];6:13. Available from: http://www.carcinogenesis.com/text.asp?2007/6/1/13/42152


  1. Background Top


Carcinoma of the lung is the most common cancer and the most frequent cause of death in the patients with cancer around the world [1]. Environmental carcinogens such as active and passive smoking, air pollution and environmental exposures have strong influences on individual factors [2]. In humans, there are several genetic polymorphisms of the enzymes involved in metabolic activation and detoxification of pulmonary carcinogens including polycyclic aromatic hydrocarbons (PAH) and aromatic amines. Interindividual differences in ability to activate and detoxify carcinogens are expected to affect the risk of developing lung cancer [3]. Polymorphisms of the genes encoding phase I and phase II xenobiotic metabolizing enzymes have been shown to be associated with susceptibility to lung cancer in a number of epidemiologic studies [4]. However, most of these studies are limited by lack of adequate statistical power. To overcome this limitation, the International Collaborative Study on Genetic Susceptibility to Environmental Carcinogens (GSEC) has begun and is on-going to pool raw data of studies on metabolic genetic polymorphisms and cancer risk [5].

Glutathione S-transferase (GSTs) plays an important role in cellular defense mechanism since they are involved in detoxification of many carcinogens and environmental pollutants and facilitate their excretion and also have a role in protection against oxidative stress [6,7]. The frequencies of polymorphic genes in control populations have been reported to be different in various ethnic groups. In addition, interethnic differences have been established [7-9]. GSTM1 deletion frequencies range from 42% to 60% in Caucasians [8].

Some studies suggest that the GSTM1 null genotype confers an increased risk of lung cancer but this result has not been approved by others, especially recent meta and pooled analysis [5, 7, 10-13].

The aims of the present study are to evaluate the frequencies of GSTM1 gene polymorphisms in Turkish population and whether genetic polymorphisms in GSTM1 influence individual susceptibility to lung cancer in Turkish population or not.


  2. Methods Top


2.1. Study subjects and sample collection

A total 256 subjects, composed of 102 lung cancer patients, who were admitted to Yedikule Teaching Hospital for Chest Diseases and Thoracic Surgery in Istanbul between 2001-2005, and 154 healthy controls were included in this study. All cancer patients and controls were born in Turkey. The control group had neither cancers nor chronic diseases. The mean ages were found to be 56.3 ± 10 (range 30-75) and 35.1 ± 11 (range 20-65) in cancer group and healthy controls, respectively. Ninety-four patients in cancer group and 110 subjects in healthy controls were smokers. This study was approved by local hospital ethics committee on human research. All patients gave informed consent.

2.2. GSTM1 genotyping

DNA samples were amplified with the primers: 5'- GAACTCCCTGAAAAGCTAAAGC -3' and 5'-GTTGGGCTCAAATATACGGTGG-3' for GSTM1 which produced a 219 bp product [14]. The PCR amplification was carried out 1 μg DNA in 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 3 mM MgCl2, 0,3 mM deoxyribonucleotide triphosphates (Fermentas), 0,2 μM of each primer and 1,5 U of Taq polymerase (Fermentas) in a total volume of 50 μl. Amplification was performed with initial denaturation at 94°C for 5 minutes, followed by 30 cycles at 94°C for 1 minute, 61°C for 1 minute, and 72°C for 1 minute, and a final extension at 72°C for 10 minute, using a MJ Research PTC160 thermal cycler. The amplification product (10 μl) was visualized in an ethidium bromide stained 1.5% agarose gel. All the genotype determination were carried out twice in independent experiments and all the inconclusive samples were reanalyzed. The results are shown in [Figure 1].

2.3. Statistical analysis

Statistical analyses were performed using the Statistical Package for the Social Sciences Program (SPSS, Version 10). Pearson's X 2 test was used to examinutee differences with regard to demographic variables, smoking and distribution of genotypes. Associations between the GSTM1 polymorphisms and risk of lung cancer were estimated using odds ratios (ORs) and 95% confidence intervals (95% CIs) calculated by conditional logistic regression.


  3. Results Top


The demographic characteristics of the cancer group and healthy controls are shown in the [Table 1]. The prevalence of GSTM1 (0/0) genotype in the cancer group was 49% compared to 52.6% in control group. But the difference was not statistically significant (OR = 1.39, 95% CI = 0.70-1.90, P = 0.55) [Table 2].

Histopathological evaluation, performed according to WHO criteria, revealed that epidermoid carcinoma, adenocarcinoma and the others types were present in 62.7% (n = 64), 24.5%(n = 25) and 12.7% (n = 13) out of 102 cancer group, respectively. There was no statistically significant difference among the histopathologic types of lung cancer (p > 0.05) and prevalence of GSTM1 polymorphism.


  4. Discussion Top


There are a lot of epidemiological and genetical studies with the expectation to monitorize the risk of lung cancer using specific biomarkers. GST gene polymorphism is one of the subject of matter. A number of studies have been tried to establish the relationship between polymorphic expression of different GSTs and lung cancer risk in different ethnic populations [7, 10, 15, 16], and the results have been conflicting [15,17]. One reason for the discrepancies could be the fact that most studies were conducted in different populations (one of the discrepancies that we encountered is due to holding the study in different populations). However, none of the main characteristics of the subjects explain satisfactorily the apparent discrepancies (i.e. race, histological type and level of smoking). Different histological subtypes of lung cancer, in particular may also be related to respective exposures or factors, and thus need to be analyzed separately [15,18].

The M1 variant of GST (GSTM1) detoxifies reactive intermediates of PAHs and other carcinogens. Although, the relationship between GSTM 1 polymorphism and lung cancer has been studied by various investigators, the effect of GSTM 0/0 null allele has not been explained clearly yet. A significant association of GSTM1 null genotype with lung cancer has already been observed in two large studies belongs to Japanese [19,20] and two in Chinese [21,22]. Furthermore, a study in Caucasians reported a significant association between lung adenocarcinoma and the GSTM1 null genotype [23]. In a meta-analysis study by Mc. Williams et al., it was shown that GSTM 0/0 null allele was a risk factor for the development of the lung cancer [24]. A meta-analysis of 11 studies found an OR of 1.6 (95% CI = 1.26-2.04) for an association between the GSTM1-null genotype and lung cancer risk [25]. A meta-analysis published by Simone Benhamou and co-workers reported that there was no statistically significant relationship between carrying GSTM null genotype and susceptibility to lung cancer but the number of the patients carrying this genotype was higher in the lung cancer group [12]. Although Pinarbasi et al. [26] reported a correlation between GTSM1 and lung cancer (p = 0.0001) in the Turkish population, the other trials conducted by Aras et al. [27] and Ozturk et al. [28] in Turkish population revealed the contrary (p > 0.05) [Table 4]. In our study, we found no statistically significant relation between GSTM null genotype and susceptibility to lung cancer. Additionally, the rate of GSTM null genotype was higher in control group than cancer patients.

The frequencies of polymorphic genes in control populations have been reported to be different in various ethnic groups. In addition, intra-ethnic differences have been established [8,9]. GSTM1 frequencies range from 42 to 60% in Caucasians [8]. GSTM1 null genotype has been shown to be 31 to 66% in Asians, Indians and Caucasians [28-30]. On the other hand, GSTM1 deletion polymorphism for African-Americans was found to be 23-35% [31] and for Chileans was 21% [10]. In these series the frequency of GSTM1 null genotype was 52,6% which was similar to some European countries (Germany, Denmark, and France), Canada, and Korea [Table 4].

When the control groups of studies performed in Turkish population are reviewed, the frequency of GSTM1 null genotype was found to be 41.2% (n = 1809). This figure is lower than European countries, United States, Saudi Arabia, Japan, Singapore, and Korea [Table 4].

Several studies have also been carried out in this regard in Turkish populations. However, some need verification and others are contradictory. GSTM1 null genotype has been shown to be 18 to 66% in Turkish population (n = 1809) [Table 3]. In Ozturk and co-workers study [28], GSTM1 null genotype incidence was found to be 49.2% in Turkish population. While Aktas et al. [27] found the prevalence of null polymorphism 34.7%; Pinarbası et al. [26] detected it to be 18% in Turkish population. The reason for this difference between both studies was attributed to regional variation of the controls included in these studies by Pınarbaşı. While Pınarbaşı included only individuals from Central Anatolia region of Turkey, Aktas did not report such a restriction [26]. In the current series the frequency of GSTM1 genotype was found to be 52.6% and is the highest among the series in Turkish population except series of Aras. The possible explanation for the high rates of the current series and Aras' series could be the inclusion of subject living in two large cities of Turkey, Istanbul and Ankara containing people from all over the country. In our previous study, there was no significant relationship between lung cancer and gene polymorphism and we had concluded that insignificancy was due to subject number inadequacy [7] but as we have involved more subjects, we could not improve the significance.

In conclusion, we observed that carrying the GSTM1 genotype is not a risk factor for lung cancer, alone. The frequencies of GSTM1-null genotype in control Turkish populations have been observed to be intra-ethnic differences. In future, the risk of lung cancer is expected to be monitorized using specific biomarkers in genetic researches.


  Competing interests Top


The author(s) declare that they have no competing interests.[38]

 
  References Top

1.National Cancer Institute: SEER Cancer Statistics Review. Bethesda, MD: National Institutes of Health; 2001:1973-1998.   Back to cited text no. 1
    
2.Perera FP: Molecular epidemiology of environmental carcinogenesis. Recent Results Cancer Res 1998, 154: 39-46.   Back to cited text no. 2
    
3.Raunio H, Husgafvel-Pursiainen K, Anttila S, Hietanen E, Hirvonen A, Pelkonen O: Diagnosis of polymorphisms in carcinogen-activating and inactivating enzymes and cancer susceptibility. Gene 1995, 159: 113-21.   Back to cited text no. 3
    
4.Strogn LC, Amos CI: Inherited susceptibility. In Cancer Epidemiology and Prevention . Edited by: Schottenfeld D, Searle JG, Fraumeni JF. Oxford University Press, NewYork; 1996:559-582.   Back to cited text no. 4
    
5.Taioli E, Gaspari L, Benhamou S, Boffetta P, Brockmoller J, Butkiewicz D, Cascorbi I, Clapper ML, Dolzan V, Haugen A, Hirvonen A, Husgafvel-Pursiainen K, Kalina I, Kremers P, Le Marchand L, London S, Rannug A, Romkes M, Schoket B, Seidegard J, Strange RC, Stucker I, To-Figueras J, Garte S: Polymorphisms in CYP1A1, GSTM1, GSTT1 and lung cancer below the age of 45 years. Int J Epidemiol 2003, 32: 60-3.   Back to cited text no. 5
    
6.Hayes JD, Pulford DJ: The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 1995, 30: 445-600.   Back to cited text no. 6
    
7.Demir A, Demir I, Altın S, Koksal V, Cetincelik U, Dincer S?: GSTM1 Gene Polymorphisms on Lung Cancer Development in the Turkish Population. Turkish Respiratory Journal 2005, 6 (1) : 131-134.   Back to cited text no. 7
    
8.Garte S, Gaspari L, Alexandrie AK, Ambrosone C, Autrup H, Autrup JL, Baranova H, Bathum L, Benhamou S, Boffetta P, Bouchardy C, Breskvar K, Brockmoller J, Cascorbi I, Clapper ML, Coutelle C, Daly A, Dell'Omo M, Dolzan V, Dresler CM, Fryer A, Haugen A, Hein DW, Hildesheim A, Hirvonen A, Hsieh LL, Ingelman-Sundberg M, Kalina I, Kang D, Kihara M, Kiyohara C, Kremers P, Lazarus P, Le Marchand L, Lechner MC, van Lieshout EMM, London S, Manni JJ, Maugard CM, Morita S, Nazar-Stewart V, Noda K, Oda Y, Parl FF, Pastorelli R, Persson I, Peters WHM, Rannug A, Rebbeck T, Risch A, Roelandt L, Romkes M, Ryberg D, Salagovic J, Schoket B, Seidegard J, Shields PG, Sim E, Sinnet D, Strange RC, Stiicker I, Sugimura H, To-Figueras J, Vineis P, Yu MC, Taioli E: Metabolic gene polymorphism frequencies in control populations. Cancer Epidemiol Biomarkers Prev 2001, 10 (12) : 1239-1248.   Back to cited text no. 8
    
9.Ada AO, Suzen SH, Iscan M: Polymorphisms of cytochrome P450 1A1, glutathione S-transferases M1 and T1 in a Turkish population. Toxicol Lett 2004, 151: 311-5.   Back to cited text no. 9
    
10.Quinones L, Berthou F, Varela N, Simon B, Gill L, Lucas D: Ethnic susceptibility to lung cancer : differences in CYP2E1, CYP1A1 and GSTM1 genetic polymorphisms between French Caucasians and Chilean populations. Cancer Lett 1999, 141: 167-71.   Back to cited text no. 10
    
11.Houlston RS: Glutathione S-transferase M1 status and lung cancer risk: a meta-analysis. Cancer Epidemiol Biomarkers Prev 1999, 8: 675-82.   Back to cited text no. 11
    
12.Benhamou S, Lee WJ, Alexandrie AK, Boffetta P, Bouchardy C, Butkiewicz D, Brockmoller J, Clapper ML, Daly A, Dolzan V, Ford J, Gaspari L, Haugen A, Hirvonen A, Husgafvel-Pursiainen K, Ingelman-Sundberg M, Kalina I, Kihara M, Kremers P, Le Marchand L, London SJ, Nazar-Stewart V, Onon-Kihara M, Rannug A, Romkes M, Ryberg D, Seidegard J, Shields P, Strange RC, Stucker I, To-Figueras J, Brennan P, Taioli E: Meta- and pooled analyses of the effects of glutathione S-transferase M1 polymorphisms and smoking on lung cancer risk. Carcinogenesis 2002, 23: 1343-50.   Back to cited text no. 12
    
13.Hung RJ, Boffetta P, Brockmoller J, Butkiewicz D, Cascorbi I, Clapper ML, Garte S, Haugen A, Hirvonen A, Anttila S, Kalina I, Le Marchand L, London SJ, Rannug A, Romkes M, Salagovic J, Schoket B, Gaspari L, Taioli E: CYP1A1 and GSTM1 genetic polymorphisms and lung cancer risk in Caucasian non-smokers: a pooled analysis. Carcinogenesis 2003, 24: 875-82.   Back to cited text no. 13
    
14.Teixeira JP, Gaspar J, Martinho G, Silva S, Rodrigues S, Mayan O, Martin E, Farmer PB, Rueff J: Aromatic DNA adduct levels in coke oven workers: correlation with polymorphisms in genes GSTP1, GSTM1, GSTT1 and CYP1A1. Mutat Res 2002, 517: 147-55.   Back to cited text no. 14
    
15.Wang J, Deng Y, Cheng J, Ding J, Tokudome S: GST genetic polymorphisms and lung adenocarcinoma susceptibility in a Chinese population. Cancer Lett 2003, 201: 185-93.   Back to cited text no. 15
    
16.Jourenkova-Mironova N, Wikman H, Bouchardy C, Voho A, Dayer P, Benhamou S, Hirvonen A: Role of glutathione S-transferase GSTM1, GSTM3, GSTP1 and GSTT1 genotypes in modulating susceptibility to smoking-related lung cancer. Pharmacogenetics 1998, 8: 495-502.   Back to cited text no. 16
    
17.Hayes JD, Strange RC: Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology 2000, 61: 154-66.   Back to cited text no. 17
    
18.Le Marchand L, Sivaraman L, Pierce L, Seifried A, Lum A, Wilkens LR, Lau AF: Associations of CYP1A1, GSTM1, and CYP2E1 polymorphisms with lung cancer suggest cell type specificities to tobacco carcinogens. Cancer Res 1998, 58: 4858-63.   Back to cited text no. 18
    
19.Hayashi S, Watanabe J, Kawajiri K: High susceptibility to lung cancer analyzed in terms of combined genotypes of P450IA1 and Mu-class glutathione S-transferase genes. Jpn J Cancer Res 1992, 83 (8) : 866-870.   Back to cited text no. 19
    
20.Kihara M, Noda K, Kihara M: Distribution of GSTM1 null genotype in relation to gender, age and smoking status in Japanese lung cancer patients. Pharmacogenetics 1995, 5 Spec: S74-S79.   Back to cited text no. 20
    
21.Lan Q, He X, Costa DJ, Tian L, Rothman N, Hu G, Mumford JL: Indoor coal combustion emissions, GSTM1 and GSTT1 genotypes, and lung cancer risk: a case-control study in Xuan Wei, China. Cancer Epidemiol Biomarkers Prev 2000, 9: 605-8.   Back to cited text no. 21
    
22.Sun GF, Shimojo N, Pi JB, Lee S, Kumagai Y: Gene deficiency of glutathione S-transferase mu isoform associated with susceptibility to lung cancer in a Chinese population. Cancer Lett 1997, 113: 169-72.   Back to cited text no. 22
    
23.Woodson K, Stewart C, Barrett M, Bhat NK, Virtamo J, Taylor PR, Albanes D: Effect of vitaminute intervention on the relationship between GSTM1, smoking, and lung cancer risk among male smokers. Cancer Epidemiol Biomarkers Prev 1999, 8: 965-70.   Back to cited text no. 23
    
24.McWilliams JE, Sanderson BJ, Harris EL, Richert-Boe KE, Henner WD: Glutathione S-transferase M1 deficiency and lung cancer risk. Cancer Epidemiol Biomarkers Prevent 1995, 4 (6) : 589-594.   Back to cited text no. 24
    
25.Errico A, Taioli E, Chen X, Vineis P: Genetic metabolic polymorphisms and the risk of cancer: a review of the literature. Biomarkers 1996, 1: 149-73.   Back to cited text no. 25
    
26.Pinarbasi H, Silig Y, Cetinkaya O, Seyfikli Z, Pinarbasi E: Strong association between the GSTM1-null genotype and lung cancer in a Turkish population. Cancer Genet Cytogenet 2003, 146 (2) : 125-129.   Back to cited text no. 26
    
27.Aras S: An Investigation on the frequency of GSTM1 gene in Turkish population by RFLP: A Correlation between null allele gene frequency and lung cancer. Ankara Universitesi Tez 2001, 1: 1-14.   Back to cited text no. 27
    
28.Ozturk O, Isbir T, Yaylim I, Kocaturk CI, Gurses A: GSTM1 and CYP1A1 gene polymorphism and daily fruit consumption in Turkish patients with non-small cell lung carcinomas. In Vivo 2003, 17: 625-32.   Back to cited text no. 28
    
29.Hong YS, Chang JH, Kwon OJ, Ham YA, Choi JH: Polymorphism of the CYP1A1 and glutathione-S-transferase gene in Korean lung cancer patients. Exp Mol Med 1998, 30: 192-8.   Back to cited text no. 29
    
30.Persson I, Johansson I, Lou YC, Yue QY, Duan LS, Bertilsson L, Ingelman-Sundberg M: Genetic polymorphism of xenobiotic metabolizing enzymes among Chinese lung cancer patients. Int J Cancer 1999, 81 (3) : 325-329.   Back to cited text no. 30
    
31.Kelsey TK, Spitz MR, Zheng-Fa Z, Wiencke JK: Polymorphisms in the glutathione S-transferase class mu and theta genes interact and increase susceptibility to lung cancer in minuteority populations (Texas, United States). Cancer Causes Control 1997, 8: 554-9.   Back to cited text no. 31
    
32.Ozbek U, Aydın M, Hatırnaz O: Metabolizing Enzyme Polymorphisms (GSTM1, GSTT1, CYP1A1, CYP2D6) and Their Association as a Potential Susceptibility to Pediatric ALL. American Society of Hematology 43rd Annual Meeting and Exposition Orlondo, December 7-11, FL 2001.   Back to cited text no. 32
    
33.Seyitoglu A, Hatırnaz O, Ozbek U: Detoksifikasyon Enzim Gen Polimorfizmlerinin Akut L φsemi Etiyolojisindeki Rolleri. Turkish Society of Hematology 30th Annual Meeting, October 10-14, 2003, ISTANBUL   Back to cited text no. 33
    
34.Aktas D, Ozen H, Atsu N, Tekin A, Sozen S, Tuncbilek E: Glutathione S-transferase M1 gene polymorphism in bladder cancer patients. A marker for invasive bladder cancer? Cancer Genet Cytogenet 2001, 125: 1-4.   Back to cited text no. 34
    
35.Toruner GA, Akyerli C, Ucar A, Aki T, Atsu N, Ozen H, Tez M, Cetinkaya M, Ozcelik T: Polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and bladder cancer susceptibility in the Turkish population. Arch Toxicol 2001, 75: 459-64.   Back to cited text no. 35
    
36.Tamer L, Calikoglu M, Ates NA, Yildirim H, Ercan B, Saritas E, Unlu A, Atik U: Glutathione-S-transferase gene polymorphisms (GSTT1, GSTM1, GSTP1) as increased risk factors for asthma. Respirology 2004, 9: 493-8.   Back to cited text no. 36
    
37.Tursen U, Tamer L, Eskandari G, Kaya TI, Ates NA, Ikizoglu G, Atik U: Glutathione S-transferase polymorphisms in patients with Behcet's disease. Arch Dermatol Res 2004, 296: 185-7.   Back to cited text no. 37
    
38.Tamer L, Ercan B, Camsari A, Yildirim H, Cicek D, Sucu N, Ates NA, Atik U: Glutathione S-transferase gene polymorphism as a susceptibility factor in smoking-related coronary artery disease. Basic Res Cardiol 2004, 99: 223-9.   Back to cited text no. 38
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]


This article has been cited by
1 Recherche d’une éventuelle association entre les polymorphismes génétiques cytochrome P4501A1*2C, glutathion-S-transférase M1 null et le cancer du poumon chez une population Tunisienne
S. Slama,A. Kenani,M. Benzarti
Journal Africain du Cancer / African Journal of Cancer. 2013; 5(1): 4
[Pubmed] | [DOI]
2 Genetic polymorphisms of CYP2E1, GST, and NAT2 enzymes are not associated with risk of breast cancer in a sample of Lebanese women
Nathalie K. Zgheib,Ashraf A. Shamseddine,Eddy Geryess,Arafat Tfayli,Ali Bazarbachi,Ziad Salem,Ali Shamseddine,Ali Taher,Nagi S. El-Saghir
Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis. 2013; 747-748: 40
[Pubmed] | [DOI]
3 Association between GSTM1, GSTT1, and GSTP1 polymorphisms and lung cancer risk in a Turkish population
Ahmet O. Ada, Semih C. Kunak, Figen Hancer, Emre Soydas, Sibel Alpar, Meral Gulhan, Mumtaz Iscan
Molecular Biology Reports. 2011;
[VIEW] | [DOI]
4 Polymorphisms in the microsomal epoxide hydrolase gene: Role in lung cancer susceptibility and prognosis
Erkisi, Z., Yaylim-Eraltan, I., Turna, A., Görmüs, U., Camlica, H., Isbir, T.
Tumori. 2010; 96(5): 756-763
[Pubmed]
5 Assessment of cumulative evidence for the association between glutathione S-transferase polymorphisms and lung cancer: application of the Venice interim guidelines :
Scott M. Langevin, John P.A. Ioannidis, Paolo Vineis, Emanuela Taioli
Pharmacogenetics and Genomics. 2010; 20(10): 586
[VIEW] | [DOI]



 

Top
Previous article  Next article
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)  

 
  In this article
Abstract
1. Background
2. Methods
3. Results
4. Discussion
Competing interests
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed5452    
    Printed504    
    Emailed0    
    PDF Downloaded456    
    Comments [Add]    
    Cited by others 5    

Recommend this journal