Close
  Indian J Med Microbiol
 

Figure 4: Loss of heterozygosity analysis. Sanger sequencing was employed to detect the upstream and downstream sequence of 300 bp above and below the knockout site of the targeted TP53 mutation in tumor tissue. Ear DNA was isolated at genotyping. Tumor tissue clearly shows the loss of the wild type allele. Cancers were predominantly T cell lymphomas and were isolated from the following 17 animal IDs: F2M2, F2M3, F2M6, F3F25, F3F16, F3M21, F3M51, F4F41, F3M27, F3F15, F3F4, F4F65, F2M1, F3F30, F1F15, F10M25, and F5F8. All 17 animals tested showed loss of heterozygosity. Table S1 for a full description of the animals and pathology. Polymerase chain reaction primers: F: CTAAACCAACTGGTGTGTAGACCCC, R: GCTCATAGGGCACCACCACA

Figure 4: Loss of heterozygosity analysis. Sanger sequencing was employed to detect the upstream and downstream sequence of 300 bp above and below the knockout site of the targeted TP53 mutation in tumor tissue. Ear DNA was isolated at genotyping. Tumor tissue clearly shows the loss of the wild type allele. Cancers were predominantly T cell lymphomas and were isolated from the following 17 animal IDs: F2M2, F2M3, F2M6, F3F25, F3F16, F3M21, F3M51, F4F41, F3M27, F3F15, F3F4, F4F65, F2M1, F3F30, F1F15, F10M25, and F5F8. All 17 animals tested showed loss of heterozygosity. Table S1 for a full description of the animals and pathology. Polymerase chain reaction primers: F: CTAAACCAACTGGTGTGTAGACCCC, R: GCTCATAGGGCACCACCACA